Topic 8 The control of gene expression

Alternative transcript:

the protein which changes the function of the protein 8 The control of gene expression 2 DNA A A A mRNA U UU Amino acids DNA mRNA UU Amino acids DNA A A A mRNA Amino acids DNA mRNA BU BI Amino acids Inversion MMM MMM Phe 8 The control of gene expression A UAC A T G U Tyr TG A C Tyr A T G UAC Tyr INO ACG Thr CTT CTC GAA Glu WW CCT G ΑΠΑΠΑ G AG Lys Gly A |TT|C A A G Lys G AG Glu CTC Glu TC A G A Arg TCC A GG Arg Normal Substitution Insertion ▾ Duplication • One or more bases are repeated and therefore produces a frame shift • Has same effect as insertion Deletion 3 • When a group of bases become separated from their DNA base sequence and rejoin at the same position but in reverse order • Changes the amino acid sequence and therefore the primary and tertiary structure of the protein Translocation Groups of bases become separated from the DNA base sequence on one chromosome and are inserted into the DNA sequence on another chromosome ● ● This leads to significant effects on the phenotype as there are different genes on different chromosomes Causes chronic myeloid leukaemia- two segments of chromosome 9 and chromosome 22 swap places • Results in gene fusion that encodes a hybrid protein that is always one and contributes to cancer by allowing the cell to divide uncontrollably Translocation ▼ Nonsense mutations • Where a stop codon is produced leading to a non-functional protein Causes Duchenne muscular dystrophy- a degenerative disease associated with muscle weakness • Caused by a mutation sin the dystrophin gene which is important in skeletal muscle cell structure and function • Nonsense mutations in the dystrophin gene cause the disease 8 The control of gene expression 4 TGCCTA TGACTA TGCOCTA TGCTA TGCATC ▼ Causes of mutation UNMUTATED DNA SUBSTITUTION Spontaneous error during DNA replication • Chemical mutagens- benzene, alcohol, asbestos, tobacco Ionising radiation- UV(causes neighbouring thymines to join together), X-ray, alpha, beta etc INSERTION DELETION INVERSION • Mutations can have neutral effects where the mutation causes no change to the organism • Some mutation can be beneficial e.g. antibiotic resistance in bacteria from the bacteria's perspective • Other mutations will have harmful effects such as mutations in the CFTR protein which causes cystic fibrosis ● 3.8.2 Gene expression is controlled by a number of features 3.8.2.1 Most of a cell's DNA is not translated ▼ Stem cells • Undifferentiated cells that can continually divide and become specialised Totipotent cells Can divide and produce any type of body cell 8 The control of gene expression 5 During development, totipotent cells translate only part of their DNA, resulting in cell specialisation • Totipotent cells occur only for a limited time in early mammalian embryos ▼ Pluripotent cells ● .Found in embryos • Can divide in unlimited numbers and differentiate into almost any type of cell • Can be used in treating human disorders e.g. regrowth of damaged skin cells, beta cells for type 1 diabetes etc • Cannot form extra embryonic cells • Issues • Stem cells can continue to divide producing a tumour o Ethical problems- destruction of an embryo o Is it right for humans to be cloned ▾ Multipotent cells .Found in mature mammals • Can differentiate into other cell types but are more limited e.g. the cells in the bone marrow- white blood cells, red blood cells ▾ Unipotent cells .Found in mature mammals • Can only differentiate into one type of cell e.g. cardiomyocytes ▼ IPS cells • Induced pluripotent stem cells • Created from adult unipotent cells(somatic) • Treated with transcription factors to switch on genes that induce pluripotency (undifferentiated) • Advantages 8 The control of gene expression 6 3.8.2.2 Regulation of transcription and translation ▼ Control of transcription ● Transcription of target genes can either be inhibited or stimulated when specific transcription factors move from the cytoplasm to the nucleus • Controlling gene expression(turning off or on) makes cells specialised Transcription factors Molecules that moves from the cytoplasm to the nucleus • Bind to DNA in the promoter/operator region, initiating/inhibiting transcription and therefore the translation of the protein • Without transcription factors the gene is turned off, so the protein isn't made o Don't cause embryonic destruction o Self-renewal- can divide indefinitely-limitless supplies o Can be used in medical treatment instead of embryonic stem cells ● ● RNA POL REPRESSOR PROMOTER NO TRANSCRIPTION 8 The control of gene expression GENE RNA POL ACTIVATOR PROMOTER GENE ▾ Role of oestrogen in initiating transcription Has the ability to alter transcription through altering transcription factors • The lipid-soluble nature of oestrogen means that it can freely diffuse across the cell membrane where it binds to a receptor molecule on a transcription factor TRANSCRIPTION 7 ● The binding alters the shape of the DNA binding site on the transcription factor and makes it able to bind to the DNA • The transcription factor changes tertiary structure so it is now complementary and can bind to the promoter region of DNA initiating transcription of genes • The transcription factor therefore enters the nucleus via the nuclear pore where it binds to DNA • This stimulates the transcription of the gene that makes up the DNA ▼ Epigenetic control • Epigenetics is environmental changes that cause heritable changes in gene function, without changes to the base sequence of DNA • Mediated by chemical tags which are collectively called the epigenome • These changes are caused by changes in the environment that inhibit transcription by: ▼ Increased methylation of DNA • When methyl groups are added to DNA at cytosine bases Prevents transcription factors from binding to promoter region of DNA • Attracts proteins that condense chromatin(DNA-histone complex), so preventing transcription as RNA polymerase can't bind . Gene is turned off ● ▼ Decreased acetylation of associated histones • Histones become more positively charged, attracting phosphate groups on DNA as phosphate is negatively charged • Causes chromatin to condense, so transcription factors and RNA polymerase can't bind 8 The control of gene expression 8 CH₂ be ▼ Treatment of disease ● CH₂ 180 DNA METHYLATION REPRESSES GENE EXPRESSION Ac HISTONE ACETYLATION ACTIVATES GENE EXPRESSION • Increased methylation/decreased acetylation-inhibition of tumour suppressor genes and proto-oncogenes 8 The control of gene expression • Decreased methylation/increased acetylation- increase in expression of tumour suppressor genes, so tumours are less likely to form • Increased in the expression of oncogenes-tumour formation Drugs can be given to prevent these changes o Drugs that reduce DNA methylation are used in chemotherapy for types of cancer that are caused by hyper-methylation of tumour suppressor genes Ac ▼ RNA interference (RNAI) • Translation from mRNA of target genes can be inhibited by RNAi mRNA is destroyed before translation to form a polypeptide chain o It's hard to make these drugs specifically target cancer cells while leaving other cells alone 9 Small strands of RNA binds to mRNA to form a double-stranded structure • This prevents the mRNA from being translated into proteins and prevents the gene from being expressed ▼ siRNA ● • Small interfering RNA • Double-stranded siRNA binds to proteins in the cytoplasm and unwinds • siRNA-enzyme complex binds to complementary bases on mRNA • siRNA is very specific- can only bind to one type of mRNA • The proteins that are bound to siRNA chop the mRNA into fragments • The small mRNA fragments are moved into a processing body for degradation 8 The control of gene expression 10 SiRNA-PROTEIN COMPLEX 1 ▼ miRNA FLT 8 The control of gene expression mRNA DEGRADED IN P-BODIES TARGET mRNA mRNA FRAGMENTED • Micro RNA • Acts the same way as siRNA but less specific, can bind to many mRNA types • miRNA binds to proteins in the cytoplasm • miRNA-protein complex binds to the target mRNA and blocks the ribosome from translating the mRNA 11 • mRNA is moved into a processing body and is either stored to be translated in the future or degraded miRNA-PROTEIN COMPLEX 3.8.2.3 Gene expression and cancer ▼ Cancer TARGET mRNA mRNA STORED OR DEGRADED IN P-BODIES TRANSLATION INHIBITED 8 The control of gene expression • The results of mutations in genes that control mitosis/ cell cycle 12 . Results in the uncontrollable division of cells and therefore the formation of a tumour • Tumours can be benign or malignant ▼ Benign tumours ● • Can grow large but at a slow rate • Can't spread or metastasise • Surrounded by a capsule and contain adhesion molecules, so remain compact and can be removed by surgery- depends on where it is growing . Often localised Malignant tumours • Grow large rapidly • Have the ability to spread to other parts of the body-metastasis • Cells can break off the tumours, travel around the body in the bloodstream or lymphatic system and invade other tissues • Develop their own blood supply • Can be life threatening and often need supplementary treatment e.g. chemotherapy and radiotherapy Compared to normal cells, cancer cells o Express different antigens on their cell membrane o Have larger, darker nuclei o Divide by mitosis more frequently o Have an irregular shape o Don't produce all the proteins that a cell needs to function properly o Don't respond to growth regulating processes ▾ Oncogenes • Mutated versions of proto-oncogenes Encodes protein involved in DNA replication and mitosis 8 The control of gene expression 13 • Genes can be permanently switched on, causing excessive cell division and tumour formation • Hypomethylation increases expression as chromatin will be less condensed Tumour suppressor genes • Encode proteins that inhibit cell division Cause apoptosis (programmed cell death) • If a mutation occurs, apoptosis is inhibited and cell division is stimulated, leading to uncontrollable cell division and tumour formation Hypermethylation leads to increased expression as chromatin is more condensed, so the gene's transcription is limited ▼ Increased oestrogen concentration ● Oestrogen production by ovaries stops at menopause • Fat cells in breast tissues produce oestrogen ● • Can cause breast cancer as oestrogen activates transcription factors and consequently the transcription of genes e.g. oncogenes • Formation of tumour results in even more oestrogen production, increasing tumour size and attracting white blood cells which increases their size even further 3.8.3 Using genome projects Genome • Full sets of genes in each cell . Can be sequenced ▼ Proteome • Full range of proteins that can be encoded by the genome Sequencing projects • Read the genomes of a variety of organisms Determining the genome of simple organisms allows the sequence of the proteins that are encoded ● 8 The control of gene expression 14 Applications o Identification of potential antigens to use in vaccines • In more complex organisms, the presence of introns means that knowledge of the genome can't be translated into the proteome ● • Allows genome-wide comparison between different species, allowing the determination of evolutionary relationships • Beneficial to medical research as genome comparisons between individuals can allow the development of personalised medications ▼ Human genome project • Has determined the sequence of bases in a human genome Applications o Screening for abnormal/mutated sequences, allowing identification of disorders before symptoms arise e.g. Huntington's disease o Pre-implantation screening • However there are ethical concerns as misused and discrimination of genetic information/data is possible ● ▼ Sequencing methods • Are constantly developing and becoming faster and more efficient to use • Have become more computer based 3.8.4 Gene technologies allow the study and alteration of gene function allowing a better understanding of organism function and the design of new industrial and medical processes 3.8.4.1 Recombinant DNA technology Recombinant DNA technology • Involves the transfer of fragments of DNA from one organism, or species, to another • The genetic code, transcription and translation machinery are universal, so transferred DNA fragments can be translated within cells of the recipient 8 The control of gene expression 15 organism- transgenic ▼ Forming/isolating DNA fragments ▼ Reverse transcriptase • Makes cDNA copies from mRNA • Naturally occurs in retroviruses e.g. HIV • Cells that produce the protein that is wanted is chosen and should have a large amount of mRNA for the protein • Reverse transcriptase can align and join the complementary DNA bases to the mRNA bases • This is single-stranded and is called complementary DNA(CDNA) • DNA polymerase makes the cDNA double-stranded • The cDNA doesn't have introns ▼ Restriction endonuclease Enzymes that cut DNA at restriction sites to form DNA fragments Complementary to a base sequence at a specific restriction site • Some cut through the same location in the double stranded DNA to produce a blunt end ● • Some create staggered ends with exposed bases. These ends are palindromic and are called sticky ends because they can join to complementary DNA base pairs 8 The control of gene expression 16 TT RESTRICTION ENZYME CATGAC CGAATTCGCACT GTACTG G CTT A AGCG TGA CATGAC CGAA G ACT G G CTT ● QO www BLUNT ENDS gene ▬▬▬▬▬▬▬▬▬▬▬ TTCGCACT AAGCG TGA 8 The control of gene expression OO www o DNA fragment RECOGNITION SEQUENCE ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬T CATGAC CGAATTCGCACT GTACTGGCTTAAGCG TGA | . . . . . . . ▾ Amplifying DNA fragments ▼ In vitro(PCR-polymerase chain reaction) • Ingredients: CATGAC C G GTAC TGGCTTAA ▬▬▬▬▬▬▬▬ U • This allows them to attach together before stronger covalent bonds form ▾ Gene machine • DNA fragments can be created using computerised methods • Scientists identify amino acid sequence of the protein of interest and the mRNA and DNA sequence from that Protecting groups are added to prevent branching of the nucleotide chain • DNA sequence is entered into a computer, which has to pass biosafety and biosecurity checks • Computer creates small sections of overlapping DNA strands called oligonucleotides • Oligonucleotides can then be joined to form the DNA sequence of the entire T AATTCGCACT GCG TGA STICKY ENDS 17 o DNA polymerase o Helicase o Primers o Nucleotides • Recipe: • The DNA fragment is heated to 95 degrees so hydrogen bonds between the base pairs break, producing 2 single DNA strands • The strands are then cooled to 55 degrees to allow primers to anneal to the DNA fragments • Primers are short sequences that allow the attachment of DNA polymerase • The mixture is then heated to 72 degrees as this is the optimum temperature for DNA polymerase • Taq polymerase attaches nucleotides together to form 2 new double stranded DNA fragments • The number of DNA fragments produced by a given number of cycles =2^x • x-number of cycles 8 The control of gene expression 18 XXXXX 00000000000000 00.000.000.000.00 00000000000000 0.00 JOU UUU nnnooooo 000000 UUUUUUUL 0000000000000 95°C DNA STRANDS SEPARATE 60°C PRIMER ANNEALS 8 The control of gene expression FREE DNA NUCLEOTIDES ALIGN ACCORDING TO BASE PAIRING RULES 72°C DNA POLYMERASE MAKES NEW DNA STRAND ▼ In vivo • DNA is cut using restriction endonuclease to create fragments with sticky ends • A promoter and terminator region is added to allow transcription • The same restriction endonuclease is used to cut open the plasmid to allow complimentary sticky ends DNA ligase is used to incorporate the DNA fragment into the plasmid 19 • Recombinant DNA is formed • The recombinant plasmid is then transferred into the bacteria via heat shock or calcium ions to increase the membrane permeability HOC 8 The control of gene expression O GENE OF INTEREST IS REMOVED USING RESTRICTION ENZYMES STICKY ENDS' ARE PRODUCED PLASMID IS CUT WITH RESTRICTION ENZYME DNA LIGASE JOINS GENE AND PLASMID TOGETHER THE GENE OF INTEREST SYNTHESISES A PROTEIN (EG. INSULIN) TO BE EXTRACTED GENE IS TAKEN UP BY BACTERIA WHICH REPLICATE TO PRODUCE MANY COPIES OF THE GENE • Not all plasmids take up the foreign DNA fragments • Not all recombinant plasmids will be taken up by the bacterial cells • We can identify which bacterial cells have taken up the recombinant plasmids through marker genes 20 Marker genes • Identifying if the plasmid was taken up o Plasmids contain antibiotic-resistance genes ● o Bacteria are grown on agar plates containing antibiotics o If bacteria have taken up the plasmid, they will survive as they will contain antibiotic resistance gene s o Bacteria will die if they haven't taken up the plasmid as they don't contain antibiotic-resistant genes Identifying if the plasmids are recombinant o DNA fragment is inserted directly in the middle of a marker gene e.g. the GFP gene which encodes fluorescence o GFP will no longer be made, so the plasmids that don't fluoresce are recombinant and those that do are non-recombinant, so they haven't taken up the foreign DNA fragment o Can be done in antibiotic resistance genes too, as recombinant plasmids wouldn't survive on agar plates with antibiotic ▾ Gene therapy • Mechanism by which genetic disorders can be cured or treated by masking the effect of the faulty allele with the insertion of the functional allele o Healthy alleles isolated and inserted into cells using vectors o If the mutant allele is recessive, a dominant allele is inserted o If the mutated allele is dominant, DNA is inserted into the middle of it to silence it • Somatic gene therapy o Alleles in body cells are altered and is not passed on to offspring • Germ-line gene therapy o Alleles in sex cells are altered, and are passed on to offspring but is considered unethical due to the concern over designer babies and safety of 8 The control of gene expression 21 gene therapy 3.8.4.2 Differences in DNA between individuals of the same species can be exploited for the identification and diagnosis of heritable conditions ▾ What and por que? • DNA probes are short sections of DNA that are complementary to a known DNA sequence e.g mutated allele • Labelled with a fluorescent/radioactive tag • Mainly used for genetic screening- the study of an individuals DNA to identify wether they ossess a mutated allele that causes a particular disease ▼ Method • Restriction enzymes digest the DNA sample into fragments which are separated by electrophoresis Separated fragments are transferred to a nylon membrane and incubated with the fluorescent DNA probe • If the allele is present, the fluorescent probe will anneal to it • The membrane is visualised under UV light- if will appear as a fluorescent band . This tells us that the allele is present on the DNA sample ▾ How do they work • The labelled DNA probe is mixed with denatured (so it doesn't replicate) DNA samples from an individual ● • If the individual has the mutant allele, the probe will bind to the complementary base sequence in one DNA strand-hybridisation • The hybridises DNA is detected using radiation and fluorescence 8 The control of gene expression 22 DNA sample DNA probes 1-3-N M gene of ● Denatured interest ▼ DNA hybridisation • DNA sequences from different species that have complementary base pairs are mixed together and therefore hybridised ssDNA • The more closely related the species are, the higher the temperature it takes to break the hydrogen bonds between the two strands Use of DNA probes • Genetic screening- to see if an individual is the carrier of a recessive mutation or to evaluate their risk of developing diseases such as cancer Allows for personalised medicine- medicine that are specifically tailored to an individual's genotype 8 The control of gene expression • Individual may have genetic counselling after the screening which provides information and support about the results of the screening and how you can lower your risk of getting a particular disease 3.8.4.3 Genetic fingerprinting Genetic fingerprinting • Used to produce a specific pattern of DNA bands from an individuals genome ▼ VNTRS • Variable number tandem repeats • Short, repeating sequences of DNA in non-coding regions • In every individual, they vary in length and in the number of repeats, so the probability of 2 individuals having the same VNTRS is very low 23 .e.g CAGCAGCAGCAGCAGCAGCAGCAG ▾ DNA fingerprinting • Extraction of the DNA of interest and amplification by PCR Digestion using specific restriction endonuclease into DNA fragments Separation of DNA fragments by gel electrophoresis ● ▾ Gel electrophoresis • DNA fragments move towards the negative electrode Smaller fragments move further down the gel • Different-sized fragments are separated into bands • VNTRS are hybridised at specific complementary base sequences with DNA probes ● The gel is developed-pattern of bands can be visualised by placing the gel on an X-ray film as the probes can emit radiation • Reveals the positions of the bands • A ladder is used as a ruler to measure the length of the fragments • Shorter fragments travel further than longer fragments through the agarose gel 8 The control of gene expression 24 DNA MIGRATES TOWARD ANODE 8 The control of gene expression CATHODE (-) ANODE (+) LONGER DNA FRAGMENT -SHORTER DNA FRAGMENT 25 (ap "Et UNA fragments vol a longer DNA fragmento cannot fit through the gel 60⁰ Can't travel as fal адалоце gel of 8 The control of gene expression Ngh further 26 ladder o are | | /\ /\ cathode (-) anode (+) Long ON A ments fragm ▾ DNA profiling • Determine genetic relationships by looking at how similar the banding patterns 6 hort DNA o fragmonto 8 The control of gene expression • Forensics- comparing DNA profile of the suspect with those found at the crime scene • Medical diagnosis- identify individuals at risk of developing particular diseases e.g. Huntington's disease • Plant and animal breeding- used to prevent inbreeding by not breeding individuals with similar banding patterns Sources: A level biology help-https://www.youtube.com/c/AlevelBiologyHelp Physics and maths tutor- https://www.physicsandmathstutor.com/biology-revision/a- level-aqa/ The science hive- https://www.thesciencehive.co.uk/aqa-biology-a-level 27